The human mitochondrial consensus genome sequence by Robert Carter

For historical reasons the standard human mitochondrial sequence, the Revised Cambridge Reference Sequence (rCRS) is a reconstruction of a single European individual’s mtDNA and contains several rare alleles. That’s why many times a usual mtDNA sequence alignment must appeal to phylogenetic historical reconstructions. The rCRS nevertheless provides a uniform nucleotide numbering scheme (0-16569). On the other hand, as there are thousands of high-quality, full-length mitochondrial sequences are now available, Robert Carter thought that it is time to construct and analyze a comprehensive human mitochondrial consensus sequence and published his efforts in Nucleic Acid Research, March, 2007: Mitochondrial diversity within modern human populations The sequence itself available as a supplementary material but with the permission of the author I copy it into this post below.

According to Robert Carter:

So far, all feedback has been good. By introducing the idea of “poly-x” sites (see later), I successfully created a technique that avoids all pre-conceived ideas about genetic history. This also allows one to effectively deal with indels, something that many authors have avoided in the mtDNA literature.

Briefly, 827 sequences were used, a master sequence alignment was created in BioEdit and BioPerl was used for all calculations using the rCRS as a template for nucleotide numbering.

A hash table that included all variant positions was created from the master alignment with sequence name and nucleotide position as keys. All calculations were performed on this hash table and output was directed to a series of text files. These calculations included a compilation of variable positions, detected alleles, allele frequencies and transition/transversion status. The worldwide human mitochondrial consensus sequence was reconstructed from the hash table by picking the majority allele at each variable position and adding in the invariant sites from the rCRS.

And the poly-x technique:

Rather than removing regions of recurrent length variation from the analysis, as is often the case in mitochondrial studies, eleven ‘poly-x’ sites were identified and dealt with separately. Each poly-x site was composed of a variable number of nucleotide repeats with at least three variants found in the data set.

>Eve1.0
gatcacaggtctatcaccctattaaccactcacgggagctctccatgcat
ttggtattttcgtctggggggtgtgcacgcgatagcattgcgagacgctg
gagccggagcaccctatgtcgcagtatctgtctttgattcctgcctcatc
ctattatttatcgcacctacgttcaatattacaggcgaacatacttacta
aagtgtgttaattaattaatgcttgtaggacataataataacaattgaat
gtctgcacagccgctttccacacagacatcataacaaaaaatttccacca
aaccccccctccccccgcttctggccacagcacttaaacacatctctgcc
aaaccccaaaaacaaagaaccctaacaccagcctaaccagatttcaaatt
ttatcttttggcggtatgcacttttaacagtcaccccccaactaacacat
tattttcccctcccactcccatactactaatctcatcaatacaacccccg
cccatcctacccagcacacacacaccgctgctaaccccataccccgaacc
aaccaaaccccaaagacaccccccacagtttatgtagcttacctcctcaa
agcaatacactgaaaatgtttagacgggctcacatcaccccataaacaaa
taggtttggtcctagcctttctattagctcttagtaagattacacatgca
agcatccccgttccagtgagttcaccctctaaatcaccacgatcaaaagg
gacaagcatcaagcacgcagcaatgcagctcaaaacgcttagcctagcca
cacccccacgggaaacagcagtgattaacctttagcaataaacgaaagtt
taactaagctatactaaccccagggttggtcaatttcgtgccagccaccg
cggtcacacgattaacccaagtcaatagaagccggcgtaaagagtgtttt
agatcaccccctccccaataaagctaaaactcacctgagttgtaaaaaac
tccagttgacacaaaatagactacgaaagtggctttaacatatctgaaca
cacaatagctaagacccaaactgggattagataccccactatgcttagcc
ctaaacctcaacagttaaatcaacaaaactgctcgccagaacactacgag
ccacagcttaaaactcaaaggacctggcggtgcttcatatccctctagag
gagcctgttctgtaatcgataaaccccgatcaacctcaccacctcttgct
cagcctatataccgccatcttcagcaaaccctgatgaaggctacaaagta
agcgcaagtacccacgtaaagacgttaggtcaaggtgtagcccatgaggt
ggcaagaaatgggctacattttctaccccagaaaactacgatagccctta
tgaaacttaagggtcgaaggtggatttagcagtaaactgagagtagagtg
cttagttgaacagggccctgaagcgcgtacacaccgcccgtcaccctcct
caagtatacttcaaaggacatttaactaaaacccctacgcatttatatag
aggagacaagtcgtaacatggtaagtgtactggaaagtgcacttggacga
accagagtgtagcttaacacaaagcacccaacttacacttaggagatttc
aacttaacttgaccgctctgagctaaacctagccccaaacccactccacc
ttactaccagacaaccttagccaaaccatttacccaaataaagtataggc
gatagaaattgaaacctggcgcaatagatatagtaccgcaagggaaagat
gaaaaattataaccaagcataatatagcaaggactaacccctataccttc
tgcataatgaattaactagaaataactttgcaaggagagccaaagctaag
acccccgaaaccagacgagctacctaagaacagctaaaagagcacacccg
tctatgtagcaaaatagtgggaagatttataggtagaggcgacaaaccta
ccgagcctggtgatagctggttgtccaagatagaatcttagttcaacttt
aaatttgcccacagaaccctctaaatccccttgtaaatttaactgttagt
ccaaagaggaacagctctttggacactaggaaaaaaccttgtagagagag
taaaaaatttaacacccatagtaggcctaaaagcagccaccaattaagaa
agcgttcaagctcaacacccactacctaaaaaatcccaaacatataactg
aactcctcacacccaattggaccaatctatcaccctatagaagaactaat
gttagtataagtaacatgaaaacattctcctccgcataagcctgcgtcag
attaaaacactgaactgacaattaacagcccaatatctacaatcaaccaa
caagtcattattaccctcactgtcaacccaacacaggcatgctcataagg
aaaggttaaaaaaagtaaaaggaactcggcaaatcttaccccgcctgttt
accaaaaacatcacctctagcatcaccagtattagaggcaccgcctgccc
agtgacacatgtttaacggccgcggtaccctaaccgtgcaaaggtagcat
aatcacttgttccttaaatagggacctgtatgaatggctccacgagggtt
cagctgtctcttacttttaaccagtgaaattgacctgcccgtgaagaggc
gggcatgacacagcaagacgagaagaccctatggagctttaatttattaa
tgcaaacagtacctaacaaacccacaggtcctaaactaccaaacctgcat
taaaaatttcggttggggcgacctcggagcagaacccaacctccgagcag
tacatgctaagacttcaccagtcaaagcgaactactatactcaattgatc
caataacttgaccaacggaacaagttaccctagggataacagcgcaatcc
tattctagagtccatatcaacaatagggtttacgacctcgatgttggatc
aggacatcccgatggtgcagccgctattaaaggttcgtttgttcaacgat
taaagtcctacgtgatctgagttcagaccggagtaatccaggtcggtttc
tatctacttcaaattcctccctgtacgaaaggacaagagaaataaggcct
acttcacaaagcgccttcccccgtaaatgatatcatctcaacttagtatt
atacccacacccacccaagaacagggtttgttaagatggcagagcccggt
aatcgcataaaacttaaaactttacagtcagaggttcaattcctcttctt
aacaacatacccatggccaacctcctactcctcattgtacccattctaat
cgcaatggcattcctaatgcttaccgaacgaaaaattctaggctatatac
aactacgcaaaggccccaacgttgtaggcccctacgggctactacaaccc
ttcgctgacgccataaaactcttcaccaaagagcccctaaaacccgccac
atctaccatcaccctctacatcaccgccccgaccttagctctcaccatcg
ctcttctactatgaacccccctccccatacccaaccccctggtcaacctc
aacctaggcctcctatttattctagccacctctagcctagccgtttactc
aatcctctgatcagggtgagcatcaaactcaaactacgccctgatcggcg
cactgcgagcagtagcccaaacaatctcatatgaagtcaccctagccatc
attctactatcaacattactaataagtggctcctttaacctctccaccct
tatcacaacacaagaacacctctgattactcctgccatcatgacccttgg
ccataatatgatttatctccacactagcagagaccaaccgaacccccttc
gaccttgccgaaggggagtccgaactagtctcaggcttcaacatcgaata
cgccgcaggccccttcgccctattcttcatagccgaatacacaaacatta
ttataataaacaccctcaccactacaatcttcctaggaacaacatatgac
gcactctcccctgaactctacacaacatattttgtcaccaagaccctact
tctaacctccctgttcttatgaattcgaacagcatacccccgattccgct
acgaccaactcatacacctcctatgaaaaaacttcctaccactcacccta
gcattacttatatgatatgtctccatacccattacaatctccagcattcc
ccctcaaacctaagaaatatgtctgataaaagagttactttgatagagta
aataataggagcttaaacccccttatttctaggactatgagaatcgaacc
catccctgagaatccaaaattctccgtgccacctatcacaccccatccta
aagtaaggtcagctaaataagctatcgggcccataccccgaaaatgttgg
ttatacccttcccgtactaattaatcccctggcccaacccgtcatctact
ctaccatctttgcaggcacactcatcacagcgctaagctcgcactgattt
tttacctgagtaggcctagaaataaacatgctagcttttattccagttct
aaccaaaaaaataaaccctcgttccacagaagctgccatcaagtatttcc
tcacgcaagcaaccgcatccataatccttctaatagctatcctcttcaac
aatatactctccggacaatgaaccataaccaatactaccaatcaatactc
atcattaataatcataatggctatagcaataaaactaggaatagccccct
ttcacttctgagtcccagaggttacccaaggcacccctctgacatccggc
ctgcttcttctcacatgacaaaaactagcccccatctcaatcatatacca
aatctctccctcactaaacgtaagccttctcctcactctctcaatcttat
ccatcatagcaggcagttgaggtggattaaaccaaacccagctacgcaaa
atcttagcatactcctcaattacccacataggatgaataatagcagttct
accgtacaaccctaacataaccattcttaatttaactatttatattatcc
taactactaccgcattcctactactcaacttaaactccagcaccacgacc
ctactactatctcgcacctgaaacaagctaacatgactaacacccttaat
tccatccaccctcctctccctaggaggcctgcccccgctaaccggctttt
tgcccaaatgggccattatcgaagaattcacaaaaaacaatagcctcatc
atccccaccatcatagccaccatcaccctccttaacctctacttctacct
acgcctaatctactccacctcaatcacactactccccatatctaacaacg
taaaaataaaatgacagtttgaacatacaaaacccaccccattcctcccc
acactcatcgcccttaccacgctactcctacctatctccccttttatact
aataatcttatagaaatttaggttaaatacagaccaagagccttcaaagc
cctcagtaagttgcaatacttaatttctgtaacagctaaggactgcaaaa
ccccactctgcatcaactgaacgcaaatcagccactttaattaagctaag
cccttactagaccaatgggacttaaacccacaaacacttagttaacagct
aagcaccctaatcaactggcttcaatctacttctcccgccgccgggaaaa
aaggcgggagaagccccggcaggtttgaagctgcttcttcgaatttgcaa
ttcaatatgaaaatcacctcggagctggtaaaaagaggcctaacccctgt
ctttagatttacagtccaatgcttcactcagccattttacctcaccccca
ctgatgttcgccgaccgttgactattctctacaaaccacaaagacattgg
aacactatacctattattcggcgcatgagctggagtcctaggcacagctc
taagcctccttattcgagccgagctgggccagccaggcaaccttctaggt
aacgaccacatctacaacgttatcgtcacagcccatgcatttgtaataat
cttcttcatagtaatacccatcataatcggaggctttggcaactgactag
ttcccctaataatcggtgcccccgatatggcgtttccccgcataaacaac
ataagcttctgactcttacctccctctctcctactcctgctcgcatctgc
tatagtggaggccggagcaggaacaggttgaacagtctaccctcccttag
cagggaactactcccaccctggagcctccgtagacctaaccatcttctcc
ttacacctagcaggtgtctcctctatcttaggggccatcaatttcatcac
aacaattatcaatataaaaccccctgccataacccaataccaaacgcccc
tcttcgtctgatccgtcctaatcacagcagtcctacttctcctatctctc
ccagtcctagctgctggcatcactatactactaacagaccgcaacctcaa
caccaccttcttcgaccccgccggaggaggagaccccattctataccaac
acctattctgatttttcggtcaccctgaagtttatattcttatcctacca
ggcttcggaataatctcccatattgtaacttactactccggaaaaaaaga
accatttggatacataggtatggtctgagctatgatatcaattggcttcc
tagggtttatcgtgtgagcacaccatatatttacagtaggaatagacgta
gacacacgagcatatttcacctccgctaccataatcatcgctatccccac
cggcgtcaaagtatttagctgactcgccacactccacggaagcaatatga
aatgatctgctgcagtgctctgagccctaggattcatctttcttttcacc
gtaggtggcctgactggcattgtattagcaaactcatcactagacatcgt
actacacgacacgtactacgttgtagctcacttccactatgtcctatcaa
taggagctgtatttgccatcataggaggcttcattcactgatttccccta
ttctcaggctacaccctagaccaaacctacgccaaaatccatttcactat
catattcatcggcgtaaatctaactttcttcccacaacactttctcggcc
tatccggaatgccccgacgttactcggactaccccgatgcatacaccaca
tgaaacatcctatcatctgtaggctcattcatttctctaacagcagtaat
attaataattttcatgatttgagaagccttcgcttcgaagcgaaaagtcc
taatagtagaagaaccctccataaacctggagtgactatatggatgcccc
ccaccctaccacacattcgaagaacccgtatacataaaatctagacaaaa
aaggaaggaatcgaaccccccaaagctggtttcaagccaaccccatggcc
tccatgactttttcaaaaaggtattagaaaaaccatttcataactttgtc
aaagttaaattataggctaaatcctatatatcttaatggcacatgcagcg
caagtaggtctacaagacgctacttcccctatcatagaagagcttatcac
ctttcatgatcacgccctcataatcattttccttatctgcttcctagtcc
tgtatgcccttttcctaacactcacaacaaaactaactaatactaacatc
tcagacgctcaggaaatagaaaccgtctgaactatcctgcccgccatcat
cctagtcctcatcgccctcccatccctacgcatcctttacataacagacg
aggtcaacgatccctcccttaccatcaaatcaattggccaccaatggtac
tgaacctacgagtacaccgactacggcggactaatcttcaactcctacat
acttcccccattattcctagaaccaggcgacctgcgactccttgacgttg
acaatcgagtagtactcccgattgaagcccccattcgtataataattaca
tcacaagacgtcttgcactcatgagctgtccccacattaggcttaaaaac
agatgcaattcccggacgtctaaaccaaaccactttcaccgctacacgac
cgggggtatactacggtcaatgctctgaaatctgtggagcaaaccacagt
ttcatgcccatcgtcctagaattaattcccctaaaaatctttgaaatagg
gcccgtatttaccctatagcaccccctctaccccctctagagcccactgt
aaagctaacttagcattaaccttttaagttaaagattaagagaaccaaca
cctctttacagtgaaatgccccaactaaatactaccgtatggcccaccat
aattacccccatactccttacactattcctcatcacccaactaaaaatat
taaacacaaactaccacctacctccctcaccaaagcccataaaaataaaa
aattataacaaaccctgagaaccaaaatgaacgaaaatctgttcgcttca
ttcattgcccccacaatcctaggcctacccgccgcagtactgatcattct
atttccccctctattgatccccacctccaaatatctcatcaacaaccgac
taatcaccacccaacaatgactaatcaaactaacctcaaaacaaatgata
accatacacaacactaaaggacgaacctgatctcttatactagtatcctt
aatcatttttattgccacaactaacctcctcggactcctgcctcactcat
ttacaccaaccacccaactatctataaacctagccatggccatcccctta
tgagcgggcgcagtgattataggctttcgctctaagattaaaaatgccct
agcccacttcttaccacaaggcacacctacaccccttatccccatactag
ttattatcgaaaccatcagcctactcattcaaccaatagccctggccgta
cgcctaaccgctaacattactgcaggccacctactcatgcacctaattgg
aagcgccaccctagcaatatcaaccattaaccttccctctacacttatca
tcttcacaattctaattctactgactatcctagaaatcgctgtcgcctta
atccaagcctacgttttcacacttctagtaagcctctacctgcacgacaa
cacataatgacccaccaatcacatgcctatcatatagtaaaacccagccc
atgacccctaacaggggccctctcagccctcctaatgacctccggcctag
ccatgtgatttcacttccactccataacgctcctcatactaggcctacta
accaacacactaaccatataccaatgatggcgcgatgtaacacgagaaag
cacataccaaggccaccacacaccacctgtccaaaaaggccttcgatacg
ggataatcctatttattacctcagaagtttttttcttcgcaggatttttc
tgagccttttaccactccagcctagcccctaccccccaattaggagggca
ctggcccccaacaggcatcaccccgctaaatcccctagaagtcccactcc
taaacacatccgtattactcgcatcaggagtatcaatcacctgagctcac
catagtctaatagaaaacaaccgaaaccaaataattcaagcactgcttat
tacaattttactgggtctctattttaccctcctacaagcctcagagtact
tcgagtctcccttcaccatttccgacggcatctacggctcaacatttttt
gtagccacaggcttccacggacttcacgtcattattggctcaactttcct
cactatctgcttcatccgccaactaatatttcactttacatccaaacatc
actttggcttcgaagccgccgcctgatactggcattttgtagatgtggtt
tgactatttctgtatgtctccatctattgatgagggtcttactcttttag
tataaatagtaccgttaacttccaattaactagttttgacaacattcaaa
aaagagtaataaacttcgccttaattttaataatcaacaccctcctagcc
ttactactaataattattacattttgactaccacaactcaacggctacat
agaaaaatccaccccttacgagtgcggcttcgaccctatatcccccgccc
gcgtccctttctccataaaattcttcttagtagctattaccttcttatta
tttgatctagaaattgccctccttttacccctaccatgagccctacaaac
aactaacctgccactaatagttatgtcatccctcttattaatcatcatcc
tagccctaagtctggcctatgagtgactacaaaaaggattagactgaacc
gaattggtatatagtttaaacaaaacgaatgatttcgactcattaaatta
tgataatcatatttaccaaatgcccctcatttacataaatattatactag
catttaccatctcacttctaggaatactagtatatcgctcacacctcata
tcctccctactatgcctagaaggaataatactatcgctgttcattatagc
tactctcataaccctcaacacccactccctcttagccaatattgtgccta
ttgccatactagtctttgccgcctgcgaagcagcggtgggcctagcccta
ctagtctcaatctccaacacatatggcctagactacgtacataacctaaa
cctactccaatgctaaaactaatcgtcccaacaattatattactaccact
gacatgactttccaaaaaacacataatttgaatcaacacaaccacccaca
gcctaattattagcatcatccctctactattttttaaccaaatcaacaac
aacctatttagctgttccccaaccttttcctccgaccccctaacaacccc
cctcctaatactaactacctgactcctacccctcacaatcatggcaagcc
aacgccacttatccagtgaaccactatcacgaaaaaaactctacctctct
atactaatctccctacaaatctccttaattataacattcacagccacaga
actaatcatattttatatcttcttcgaaaccacacttatccccaccttgg
ctatcatcacccgatgaggcaaccagccagaacgcctgaacgcaggcaca
tacttcctattctacaccctagtaggctcccttcccctactcatcgcact
aatttacactcacaacaccctaggctcactaaacattctactactcactc
tcactgcccaagaactatcaaactcctgagccaacaacttaatatgacta
gcttacacaatagcttttatagtaaagatacctctttacggactccactt
atgactccctaaagcccatgtcgaagcccccatcgctgggtcaatagtac
ttgccgcagtactcttaaaactaggcggctatggtataatacgcctcaca
ctcattctcaaccccctgacaaaacacatagcctaccccttccttgtact
atccctatgaggcataattataacaagctccatctgcctacgacaaacag
acctaaaatcgctcattgcatactcttcaatcagccacatagccctcgta
gtaacagccattctcatccaaaccccctgaagcttcaccggcgcagtcat
tctcataatcgcccacggacttacatcctcattactattctgcctagcaa
actcaaactacgaacgcactcacagtcgcatcataatcctctctcaagga
cttcaaactctactcccactaatagctttttgatgacttctagcaagcct
cgctaacctcgccttaccccccactattaacctactgggagaactctctg
tgctagtaaccacgttctcctgatcaaatatcactctcctacttacagga
ctcaacatactagtcacagccctatactccctctacatatttaccacaac
acaatggggctcactcacccaccacattaacaacataaaaccctcattca
cacgagaaaacaccctcatgttcatacacctatcccccattctcctccta
tccctcaaccccgacatcattaccgggttttcctcttgtaaatatagttt
aaccaaaacatcagattgtgaatctgacaacagaggcttacgacccctta
tttaccgagaaagctcacaagaactgctaactcatgcccccatgtctaac
aacatggctttctcaacttttaaaggataacagctatccattggtcttag
gccccaaaaattttggtgcaactccaaataaaagtaataaccatgcacac
tactataaccaccctaaccctgacttccctaattccccccatccttacca
ccctcgttaaccctaacaaaaaaaactcatacccccattatgtaaaatcc
attgtcgcatccacctttattatcagtctcttccccacaacaatattcat
gtgcctagaccaagaagttattatctcgaactgacactgagccacaaccc
aaacaacccagctctccctaagcttcaaactagactacttctccataata
ttcatccctgtagcattgttcgttacatggtccatcatagaattctcact
gtgatatataaactcagacccaaacattaatcagttcttcaaatatctac
tcatcttcctaattaccatactaatcttagttaccgctaacaacctattc
caactgttcatcggctgagagggcgtaggaattatatccttcttgctcat
cagttgatgatacgcccgagcagatgccaacacagcagccattcaagcaa
tcctatacaaccgtatcggcgatatcggtttcatcctcgccttagcatga
tttatcctacactccaactcatgagacccacaacaaatagcccttctaaa
cgctaatccaagcctcaccccactactaggcctcctcctagcagcagcag
gcaaatcagcccaattaggtctccacccctgactcccctcagccatagaa
ggccccaccccagtctcagccctactccactcaagcactatagttgtagc
aggaatcttcttactcatccgcttccaccccctagcagaaaatagcccac
taatccaaactctaacactatgcttaggcgctatcaccactctgttcgca
gcagtctgcgcccttacacaaaatgacatcaaaaaaatcgtagccttctc
cacttcaagtcaactaggactcataatagttacaatcggcatcaaccaac
cacacctagcattcctgcacatctgtacccacgccttcttcaaagccata
ctatttatgtgctccgggtccatcatccacaaccttaacaatgaacaaga
tattcgaaaaataggaggactactcaaaaccatacctctcacttcaacct
ccctcaccattggcagcctagcattagcaggaatacctttcctcacaggt
ttctactccaaagaccacatcatcgaaaccgcaaacatatcatacacaaa
cgcctgagccctatctattactctcatcgctacctccctgacaagcgcct
atagcactcgaataattcttctcaccctaacaggtcaacctcgcttcccc
acccttactaacattaacgaaaataaccccaccctactaaaccccattaa
acgcctggcagccggaagcctattcgcaggatttctcattactaacaaca
tttcccccgcatcccccttccaaacaacaatccccctctacctaaaactc
acagccctcgctgtcactttcctaggacttctaacagccctagacctcaa
ctacctaaccaacaaacttaaaataaaatccccactatgcacattttatt
tctccaacatactcggattctaccctagcatcacacaccgcacaatcccc
tatctaggccttcttacgagccaaaacctgcccctactcctcctagacct
aacctgactagaaaagctattacctaaaacaatttcacagcaccaaatct
ccacctccatcatcacctcaacccaaaaaggcataattaaactttacttc
ctctctttcttcttcccactcatcctaaccctactcctaatcacataacc
tattcccccgagcaatctcaattacaatatatacaccaacaaacaatgtt
caaccagtaactactactaatcaacgcccataatcatacaaagcccccgc
accaataggatcctcccgaatcaaccctgacccctctccttcataaatta
ttcagcttcctacactattaaagtttaccacaaccaccaccccatcatac
tctttcacccacagcaccaatcctacctccatcgctaaccccactaaaac
actcaccaagacctcaacccctgacccccatgcctcaggatactcctcaa
tagccatcgctgtagtatatccaaagacaaccatcattccccctaaataa
attaaaaaaactattaaacccatataacctcccccaaaattcagaataat
aacacacccgaccacaccgctaacaatcaatactaaacccccataaatag
gagaaggcttagaagaaaaccccacaaaccccattactaaacccacactc
aacagaaacaaagcatacatcattattctcgcacggactacaaccacgac
caatgatatgaaaaaccatcgttgtatttcaactacaagaacaccaatga
ccccaatacgcaaaattaaccccctaataaaattaattaaccactcattc
atcgacctccccaccccatccaacatctccgcatgatgaaacttcggctc
actccttggcgcctgcctgatcctccaaatcaccacaggactattcctag
ccatgcactactcaccagacgcctcaaccgccttttcatcaatcgcccac
atcactcgagacgtaaattatggctgaatcatccgctaccttcacgccaa
tggcgcctcaatattctttatctgcctcttcctacacatcgggcgaggcc
tatattacggatcatttctctactcagaaacctgaaacatcggcattatc
ctcctgcttgcaactatagcaacagccttcataggctatgtcctcccgtg
aggccaaatatcattctgaggggccacagtaattacaaacttactatccg
ccatcccatacattgggacagacctagttcaatgaatctgaggaggctac
tcagtagacagtcccaccctcacacgattctttacctttcacttcatctt
gcccttcattattgcagccctagcagcactccacctcctattcttgcacg
aaacgggatcaaacaaccccctaggaatcacctcccattccgataaaatc
accttccacccttactacacaatcaaagacgccctcggcttacttctctt
ccttctctccttaatgacattaacactattctcaccagacctcctaggcg
acccagacaattataccctagccaaccccttaaacacccctccccacatc
aagcccgaatgatatttcctattcgcctacacaattctccgatccgtccc
taacaaactaggaggcgtccttgccctattactatccatcctcatcctag
caataatccccatcctccatatatccaaacaacaaagcataatatttcgc
ccactaagccaatcactttattgactcctagccgcagacctcctcattct
aacctgaatcggaggacaaccagtaagctacccttttaccatcattggac
aagtagcatccgtactatacttcacaacaatcctaatcctaataccaact
atctccctaattgaaaacaaaatactcaaatgggcctgtccttgtagtat
aaactaatacaccagtcttgtaaaccggagatgaaaacctttttccaagg
acaaatcagagaaaaagtctttaactccaccattagcacccaaagctaag
attctaatttaaactattctctgttctttcatggggaagcagatttgggt
accacccaagtattgactcacccatcaacaaccgctatgtatttcgtaca
ttactgccagccaccatgaatattgtacggtaccataaatacttgaccac
ctgtagtacataaaaacccaatccacatcaaaaccccctccccatgctta
caagcaagtacagcaatcaaccctcaactatcacacatcaactgcaactc
caaagccacccctcacccactaggataccaacaaacctacccacccttaa
cagtacatagtacataaagccatttaccgtacatagcacattacagtcaa
atcccttctcgtccccatggatgacccccctcagataggggtcccttgac
caccatcctccgtgaaatcaatatcccgcacaagagtgctactctcctcg
ctccgggcccataacacttgggggtagctaaagtgaactgtatccgacat
ctggttcctacttcagggccataaagcctaaatagcccacacgttcccct
taaataagacatcacgatg